pMBD-Gate2
(Plasmid
#25947)
-
Depositing Lab
-
Depositing OrganizationUniversity of Salzburg
Located in Austria -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 25947 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 25947-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 25947-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepBIND
-
Backbone manufacturerPromega
- Backbone size w/o insert (bp) 6360
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol and Ampicillin, 25 & 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)ccdB Survival
-
Growth instructionsStrain (ccdB Survival Strain): F- mcrA Δ(mrr-hsdRMS-mcrBC) Φ80lacZΔM15 ΔlacX74 recA1 araΔ139 Δ(ara-leu)7697 galU galK rpsL (StrR) endA1 nupG fhuA::IS2 ; Growth condition: 37°C
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameNone
-
Insert Size (bp)1713
-
Tag
/ Fusion Protein
- GAL4 Fusion Protein (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRV (not destroyed)
- 3′ cloning site EcoRV (not destroyed)
- 5′ sequencing primer TGCCGTCACAGATAGATTGG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 25947-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 25947-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMBD-Gate2 was a gift from Kamil Onder (Addgene plasmid # 25947 ; http://n2t.net/addgene:25947 ; RRID:Addgene_25947) -
For your References section:
Coupled yeast 2-hybrid-mammalian 2-hybrid reading-frame-independent and site-specific recombinational cloning vector system. Maier CJ, Maier RH, Hintner H, Bauer JW, Onder K. Assay Drug Dev Technol. 2010 Oct;8(5):625-9. doi: 10.1089/adt.2009.0266. Epub 2010 Jun 1. 10.1089/adt.2009.0266 PubMed 20515414