pCDH-mCherry-Rab7
(Plasmid
#259720)
-
PurposeExpresses Rab7 in mammalian cells, used as a late endosome/lysosome marker
-
Depositing Lab
-
Depositing OrganizationUniversity of Pittsburgh (University, School of Medicine, and Cancer Institute)
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 259720 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepCDH
- Backbone size w/o insert (bp) 7403
- Total vector size (bp) 8753
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameRab7
-
SpeciesCanis lupus familiaris
-
Insert Size (bp)1350
-
GenBank IDNM_001003316
-
Entrez GeneRAB7A (a.k.a. RAB7)
- Promoter CMV
-
Tag
/ Fusion Protein
- mcherry (N terminal on insert)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer GGCACCAAAATCAACGGGAC
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byaddgene plasmid #20164
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCDH-mCherry-Rab7 was a gift from Xiaojun Tan (Addgene plasmid # 259720 ; http://n2t.net/addgene:259720 ; RRID:Addgene_259720) -
For your References section:
A conserved ion channel function of STING mediates noncanonical autophagy and cell death. Xun J, Zhang Z, Lv B, Lu D, Yang H, Shang G, Tan JX. EMBO Rep. 2024 Feb;25(2):544-569. doi: 10.1038/s44319-023-00045-x. Epub 2024 Jan 2. 10.1038/s44319-023-00045-x PubMed 38177926