pSecGFP1h
(Plasmid #259741)

• Purpose: Plasmid for secretion of sfGFP into the extracellular space in evolved E. coli Nissle 1917 derivatives
• Depositing Lab: Anton Kan
• Depositing Organization: ETH Zurich (Swiss Federal Institute of Technology)
  Located in Switzerland
• Publication: Kan et al ACS Synth. Biol. (2026)

Backbone

• Vector backbone: pSB4K5
• Total vector size (bp): 7866
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert 1

• Gene/Insert name: SecGFP
• Species: Synthetic
• Insert Size (bp): 864
• Promoter: pL-Lac
• Tags / Fusion Proteins:
  • 6xHis (C terminal on insert)
  • Sec:N22 secretion tag from E. coli csgA (N terminal on insert)

Cloning Information for Gene/Insert 1

• Cloning method: Gibson Cloning
• 5′ sequencing primer: gctgttgcccgtctcactgg

Gene/Insert 2

• Gene/Insert name: csgEFG
• Species: E. coli
• Insert Size (bp): 1734
• Promoter: J23101

Cloning Information for Gene/Insert 2

• Cloning method: Gibson Cloning
• 5′ sequencing primer: GCACTGAAGGTCCTCAATCG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry