Skip to main content
Addgene
Open Menu

pICH41258 Red-FAST
(Plasmid #259752)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 259752 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Add to Cart

Backbone

  • Vector backbone
    pICH41258
  • Backbone size w/o insert (bp) 2845
  • Total vector size (bp) 2652
  • Vector type
    MoClo Cloning

Growth in Bacteria

  • Bacterial Resistance(s)
    Spectinomycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Red-FAST
  • Species
    Synthetic
  • Insert Size (bp)
    373

Cloning Information

  • Cloning method Golden Gate
  • 5′ sequencing primer cgttatcccctgattctgtggataac
  • 3′ sequencing primer gtctcatgagcggatacatatttgaatg
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Originally, Red-Fast protein comes from Arnaud GAUTIER, Sorbonne Université, Ecole Normale Supérieure, Université PSL, CNRS, Laboratoire des Biomolécules, LBM, Paris 75005, France. Tebo, A.G., Moeyaert, B., Thauvin, M. et al. Orthogonal fluorescent chemogenetic reporters for multicolor imaging. Nat Chem Biol 17, 30–38 (2021). https://doi.org/10.1038/s41589-020-0611-0

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pICH41258 Red-FAST was a gift from Yonghua Li-Beisson (Addgene plasmid # 259752 ; http://n2t.net/addgene:259752 ; RRID:Addgene_259752)

  • For your References section:

    The fluorescence-activating and absorption-shifting tag (FAST), a versatile protein marker for live plant cell imaging. David P, Michaud M, Moyet L, Pullara S, Lacombe B, Zhu J, Gautier A, Desnos T, Bertrand E, Rolland N, Nussaume L. Plant J. 2026 Jun;126(5):e70966. doi: 10.1111/tpj.70966. 10.1111/tpj.70966 PubMed 42284563
Related items: