pICH41258 Red-FAST
(Plasmid
#259752)
-
PurposeFluorescent reporter Tag for Plants
-
Depositing Lab
-
Depositing OrganizationCNRS UMR 7265 Institut Biosciences et Biotechnologie d'Aix- Marseille (BIAM)
Located in France -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 259752 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepICH41258
- Backbone size w/o insert (bp) 2845
- Total vector size (bp) 2652
-
Vector typeMoClo Cloning
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameRed-FAST
-
SpeciesSynthetic
-
Insert Size (bp)373
Cloning Information
- Cloning method Golden Gate
- 5′ sequencing primer cgttatcccctgattctgtggataac
- 3′ sequencing primer gtctcatgagcggatacatatttgaatg
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byOriginally, Red-Fast protein comes from Arnaud GAUTIER, Sorbonne Université, Ecole Normale Supérieure, Université PSL, CNRS, Laboratoire des Biomolécules, LBM, Paris 75005, France. Tebo, A.G., Moeyaert, B., Thauvin, M. et al. Orthogonal fluorescent chemogenetic reporters for multicolor imaging. Nat Chem Biol 17, 30–38 (2021). https://doi.org/10.1038/s41589-020-0611-0
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pICH41258 Red-FAST was a gift from Yonghua Li-Beisson (Addgene plasmid # 259752 ; http://n2t.net/addgene:259752 ; RRID:Addgene_259752) -
For your References section:
The fluorescence-activating and absorption-shifting tag (FAST), a versatile protein marker for live plant cell imaging. David P, Michaud M, Moyet L, Pullara S, Lacombe B, Zhu J, Gautier A, Desnos T, Bertrand E, Rolland N, Nussaume L. Plant J. 2026 Jun;126(5):e70966. doi: 10.1111/tpj.70966. 10.1111/tpj.70966 PubMed 42284563