pHAGE-PGK-DsRed-IRES-GFP-EF1a-blast
(Plasmid
#259767)
-
PurposePGK-driven Global Protein Stability (GPS) reporter with blasticidin resistance
-
Depositing Lab
-
Depositing OrganizationBrigham and Women's Hospital
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 259767 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepHAGE
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameDsRed-IRES-GFP
-
SpeciesSynthetic
- Promoter PGK
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer CATTCTGCACGCTTCAAAAG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
pHAGE vector originally based on pHAGE-CAGS-W vector (Dr. Richard Mulligan, Harvard Institute of Medicine, Boston)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pHAGE-PGK-DsRed-IRES-GFP-EF1a-blast was a gift from Stephen Elledge (Addgene plasmid # 259767 ; http://n2t.net/addgene:259767 ; RRID:Addgene_259767) -
For your References section:
Virome-wide ubiquitin ligase discovery reveals diverse mechanisms of immune evasion. Glassman CR, Baek K, Hou G, Zeng Q, Nardone C, Juergens KB, Fujimura E, O'Leary CN, Li MZ, Paulo JA, Fischer ES, Ding S, Harper JW, Elledge SJ. Science. 2026 Jul 9. doi: 10.1126/science.aec6299. 10.1126/science.aec6299 PubMed 42424437