pINDUCER20-mCD19
(Plasmid
#259772)
-
PurposeLentiviral vector containing constitutively expressed rtTA and doxycycline-inducible mouse CD19 marker
-
Depositing Lab
-
Depositing OrganizationBrigham and Women's Hospital
Located in the United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 259772 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepINDUCER
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCD19
-
SpeciesM. musculus (mouse)
-
Entrez GeneCd19
- Promoter TRE
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer GTTTGTACAAAAAAGCAGGC
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please note that the depositor's annotated reference file has minor differences compared to the Addgene verified sequence. Please refer to the the Addgene sequence for the most accurate result.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pINDUCER20-mCD19 was a gift from Stephen Elledge (Addgene plasmid # 259772 ; http://n2t.net/addgene:259772 ; RRID:Addgene_259772) -
For your References section:
Virome-wide ubiquitin ligase discovery reveals diverse mechanisms of immune evasion. Glassman CR, Baek K, Hou G, Zeng Q, Nardone C, Juergens KB, Fujimura E, O'Leary CN, Li MZ, Paulo JA, Fischer ES, Ding S, Harper JW, Elledge SJ. Science. 2026 Jul 9. doi: 10.1126/science.aec6299. 10.1126/science.aec6299 PubMed 42424437