pDRESS-rsmiRFPnano
(Plasmid
#259781)
-
PurposeExpresses near-infrared photochromic protein
-
Depositing Lab
-
Depositing OrganizationUniversity of Helsinki, Institute of Biomedicine
Located in Finland -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 259781 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepTriEx-3
-
Backbone manufacturerNovagen
- Total vector size (bp) 5399
-
Vector typeMammalian Expression, Bacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namersmiRFPnano
-
SpeciesSynthetic
-
Insert Size (bp)489
- Promoter CMV & Rha
-
Tag
/ Fusion Protein
- His (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NcoI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer catcatcacgttcatctttccc
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDRESS-rsmiRFPnano was a gift from Vladislav Verkhusha (Addgene plasmid # 259781 ; http://n2t.net/addgene:259781 ; RRID:Addgene_259781)