rsmiRFPnano-based NF-κB reporter
(Plasmid
#259785)
-
PurposeNF-κB reporter
-
Depositing Lab
-
Depositing OrganizationUniversity of Helsinki, Institute of Biomedicine
Located in Finland -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 259785 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepNL3.2
-
Backbone manufacturerPromega
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namersmiRFPnano
-
SpeciesSynthetic
-
Insert Size (bp)489
- Promoter minP
Cloning Information
- Cloning method Other
- 5′ sequencing primer gagcttccattatataccctc
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
rsmiRFPnano-based NF-κB reporter was a gift from Vladislav Verkhusha (Addgene plasmid # 259785 ; http://n2t.net/addgene:259785 ; RRID:Addgene_259785)