Skip to main content
Addgene
Open Menu

pet26b_SpnA_H716G_S729C
(Plasmid #260160)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 260160 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Add to Cart

Backbone

  • Vector backbone
    pET-26b(+)
  • Backbone size w/o insert (bp) 5400
  • Total vector size (bp) 7691
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    Room Temperature
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    For protein production, the depositing lab recommends using Tuner (DE3) E. coli and growing at 18 °C for 21 hours.
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    nuclease A
  • Alt name
    SpnA
  • Species
    Streptococcus pyogenes
  • Insert Size (bp)
    2457
  • Mutation
    Changed Histidine 716 to Glycine
  • Promoter T7 promoter
  • Tag / Fusion Protein
    • 6xHis-HA-StrepII-TEV (histidine–hemagglutinin–StrepII–Tobacco Etch Mosaic Virus protease recognition site) (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NedI (unknown if destroyed)
  • 3′ cloning site Xhol (unknown if destroyed)
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer CTAGTTATTGCTCAGCGGT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://doi.org/10.1101/2025.08.25.672074 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pet26b_SpnA_H716G_S729C was a gift from Lotta Happonen (Addgene plasmid # 260160 ; http://n2t.net/addgene:260160 ; RRID:Addgene_260160)

  • For your References section:

    Molecular mechanism of complement interference by Streptococcus pyogenes nuclease A. Bennig IA, Ströbaek J, Mamede R, Sellerberg A, Neumann A, Friães A, Ramirez M, Hall M, Collin M, Malmström L, Ekström S, Frick IM, Björck L, Happonen LJ. Communications Biology volume 9, Article number: 1245 (2026) 10.1038/s42003-026-10956-9
Related items: