Skip to main content

pLentiBirA-Occln
(Plasmid #260880)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 260880 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    lentiCRISPR v2
  • Backbone manufacturer
    Feng Zhang (Addgene #52961)
  • Total vector size (bp) 11450
  • Modifications to backbone
    removal of Cas9 coding sequence; addition of 20 nucleotides gRNA after the U6 promoter
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    Occludin
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    3285
  • Promoter EF1a
  • Tags / Fusion Proteins
    • BirA (N terminal on insert)
    • P2A-Puro (C terminal on insert)

Cloning Information for Gene/Insert 1

Gene/Insert 2

  • Gene/Insert name
    sgRNA targeting Occludin
  • Alt name
    sgRNA: ATGACATGGCTGATTGTCAA
  • Species
    H. sapiens (human)
  • Entrez Gene
    OCLN (a.k.a. BLCPMG, PPP1R115, PTORCH1)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Michael Davidson (Occludin coding sequence was obtained from plasmid mCherry-Occludin-N-10 (Addgene #55112)) and Kyle Roux (BirA coding sequence was obtained from pcDNA3.1 mycBioID (Addgene #35700)).

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLentiBirA-Occln was a gift from Montse Masoliver (Addgene plasmid # 260880 ; http://n2t.net/addgene:260880 ; RRID:Addgene_260880)