pLentiBirA-Occln
(Plasmid #260880)

• Purpose: Used for the production of recombinant lentiviruses encoding a fusion protein comprising the biotin ligase BirA fused to the transmembrane protein occludin.
• Depositing Lab: Montse Masoliver
• Depositing Organization: Universitat de Vic - Universitat Central de Catalunya
  Located in Spain
• Publication: Study of occludin interactors (unpublished)

Backbone

• Vector backbone: lentiCRISPR v2
• Backbone manufacturer: Feng Zhang (Addgene #52961)
• Total vector size (bp): 11450
• Modifications to backbone: removal of Cas9 coding sequence; addition of 20 nucleotides gRNA after the U6 promoter
• Vector type: Mammalian Expression, Lentiviral, CRISPR
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: Occludin
• Species: H. sapiens (human)
• Insert Size (bp): 3285
• Promoter: EF1a
• Tags / Fusion Proteins:
  • BirA (N terminal on insert)
  • P2A-Puro (C terminal on insert)

Cloning Information for Gene/Insert 1

• Cloning method: Gibson Cloning
• 5′ sequencing primer: several custom made

Gene/Insert 2

• Gene/Insert name: sgRNA targeting Occludin
• Alt name: sgRNA: ATGACATGGCTGATTGTCAA
• Species: H. sapiens (human)
• Entrez Gene: OCLN (a.k.a. BLCPMG, PPP1R115, PTORCH1)

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Michael Davidson (Occludin coding sequence was obtained from plasmid mCherry-Occludin-N-10 (Addgene #55112)) and Kyle Roux (BirA coding sequence was obtained from pcDNA3.1 mycBioID (Addgene #35700)).

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry