This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pHR-SIN-GFP-PTEN-WT
(Plasmid #30391)

Loading...

Full plasmid sequence is not available for this item.

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 30391 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Backbone

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    GFP-PTEN-WT
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1935
  • Mutation
    GFP-PTEN-WT
  • GenBank ID
    U93051
  • Entrez Gene
    PTEN (a.k.a. 10q23del, BZS, CWS1, DEC, GLM2, MHAM, MMAC1, PTEN1, PTENbeta, TEP1)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamH I (not destroyed)
  • 3′ cloning site Not I (not destroyed)
  • 5′ sequencing primer CCAAGGACCTGAAATGACCC
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pHR-SIN-GFP-PTEN-WT was a gift from Todd Waldman (Addgene plasmid # 30391 ; http://n2t.net/addgene:30391 ; RRID:Addgene_30391)
  • For your References section:

    Mechanistic Analysis of a DNA Damage-Induced, PTEN-Dependent Size Checkpoint in Human Cells. Kim JS, Xu X, Li H, Solomon D, Lane WS, Jin T, Waldman T. Mol Cell Biol. 2011 Jul . 31(13):2756-71. 10.1128/MCB.01323-10 PubMed 21536651