Skip to main content
Addgene
Open Menu

Beclin-BATS
(Plasmid #30498)

Print

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 30498 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Add to Cart
DNA 30498-D50 50 μg of DNA in Tris buffer $495
Add to Cart
DNA 30498-D100 100 μg of DNA in Tris buffer $585
Add to Cart

Backbone

  • Vector backbone
    phrGFP-N1
  • Backbone manufacturer
    Agilent Technologies
  • Backbone size w/o insert (bp) 4300
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Beclin, Barkor
  • Alt name
    ATG6; ATG14L/ATG14
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1592
  • Mutation
    Beclin 1 + 413-492 aa of Barkor
  • GenBank ID
    AF139131 KIAA0831
  • Entrez Gene
    BECN1 (a.k.a. ATG6, VPS30, beclin1)
  • Entrez Gene
    ATG14 (a.k.a. ATG14L, BARKOR, KIAA0831)
  • Tags / Fusion Proteins
    • hrGFP (N terminal on backbone)
    • 3xFlag (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BglII (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer CAGCTGACCAGCCTGGGCAAG
  • 3′ sequencing primer TAATACGACTCACTATAGGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Beclin-BATS was a gift from Qing Zhong (Addgene plasmid # 30498 ; http://n2t.net/addgene:30498 ; RRID:Addgene_30498)

  • For your References section:

    Autophagosome targeting and membrane curvature sensing by Barkor/Atg14(L). Fan W, Nassiri A, Zhong Q. Proc Natl Acad Sci U S A. 2011 May 10;108(19):7769-74. doi: 10.1073/pnas.1016472108. Epub 2011 Apr 25. 10.1073/pnas.1016472108 PubMed 21518905
Related items:
Commonly requested with: