Skip to main content
Addgene
Open Menu

pPSmOrange-C1
(Plasmid #31899)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 31899 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Add to Cart
DNA 31899-D50 50 μg of DNA in Tris buffer $495
Add to Cart
DNA 31899-D100 100 μg of DNA in Tris buffer $585
Add to Cart

Backbone

  • Vector backbone
    pC1
  • Backbone manufacturer
    Clontech
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    PSmOrange
  • Insert Size (bp)
    708
  • Mutation
    S21T, Q63L, F100Y, L125M, K166R, P192S (mutations are relative to mOrange but numbering is relative to EGFP)
  • GenBank ID
    JN_376081

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site BglII (not destroyed)
  • 5′ sequencing primer cggtaggcgtgtacggtgggag
  • 3′ sequencing primer SV40pA-R
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pPSmOrange-C1 was a gift from Vladislav Verkhusha (Addgene plasmid # 31899 ; http://n2t.net/addgene:31899 ; RRID:Addgene_31899)

  • For your References section:

    A photoswitchable orange-to-far-red fluorescent protein, PSmOrange. Subach OM, Patterson GH, Ting LM, Wang Y, Condeelis JS, Verkhusha VV. Nat Methods. 2011 Jul 31;8(9):771-7. doi: 10.1038/nmeth.1664. 10.1038/nmeth.1664 PubMed 21804536
Related items:
Commonly requested with: