Skip to main content

pENTR-R4r-LucmiR-EGFP-R3r
(Plasmid #32589)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 32589 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pDONR221 P4r-P3r
  • Backbone manufacturer
    Invitrogen
  • Vector type
    Gateway Cloning

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    Stbl2
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Intronic Luciferase miRNA and EGFP

Cloning Information

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    pSM155-Luc-GFP was provided by Guangwei Du, University of Texas Health Science Center, Houston. A cassette containing the intronic Luciferase miRNA upstream of EGFP was then amplified with PCR primers containing att sites and recombined to generate the entry vector.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Luc miRNA atttgtattcagcccatatcgg

Du, G., Yonekubo, J., Zeng, Y., Osisami, M., and Frohman, M. A. (2006). Design of expression vectors for RNA interference based on miRNAs and RNA splicing. FEBS J. 273, 5421–5427.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pENTR-R4r-LucmiR-EGFP-R3r was a gift from Matthew Nolan (Addgene plasmid # 32589 ; http://n2t.net/addgene:32589 ; RRID:Addgene_32589)
  • For your References section:

    A Molecular Toolbox for Rapid Generation of Viral Vectors to Up- or Down-Regulate Neuronal Gene Expression in vivo. White MD, Milne RV, Nolan MF. Front Mol Neurosci. 2011;4:8. Epub 2011 Jul 4. 10.3389/fnmol.2011.00008 PubMed 21772812