Skip to main content

pAAV-SEPT-FLAG-p53 KI vector
(Plasmid #32807)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 32807 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pAAV-SEPT
  • Vector type
    Mammalian Expression, Bacterial Expression, AAV
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH10B
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    p53 homology
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1000
  • Entrez Gene
    TP53 (a.k.a. BCC7, BMFS5, LFS1, P53, TRP53)
  • Tag / Fusion Protein
    • FLAG

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Age I (not destroyed)
  • 3′ cloning site Sac I (not destroyed)
  • 5′ sequencing primer GGGAGGTGTGGGAGGTTTT
  • 3′ sequencing primer GGAGTACTCACCCCAACAGC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-SEPT-FLAG-p53 KI vector was a gift from Todd Waldman (Addgene plasmid # 32807)
  • For your References section:

    Epitope tagging of endogenous genes in diverse human cell lines. Kim JS, Bonifant C, Bunz F, Lane WS, Waldman T. Nucleic Acids Res. 2008 Nov . 36(19):e127. 10.1093/nar/gkn566 PubMed 18784188