pCDNA 3.1 Flag-rat-PTP1B
(Plasmid #35988)

• Depositing Lab: Anna Huttenlocher
• Depositing Organization: University of Wisconsin, Madison
  Located in United States of America
• Publication: Cortesio et al J Cell Biol. 2008 Mar 10;180(5):957-71.
• Citations: 3 Articles

Backbone

• Vector backbone: pcDNA3.1
• Backbone manufacturer: Invitrogen
• Backbone size w/o insert (bp): 5427
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: protein tyrosine phosphatase 1B
• Alt name: PTP1B
• Species: R. norvegicus (rat)
• Insert Size (bp): 1299
• Entrez Gene: Ptpn1 (a.k.a. Ptp)
• Promoter: CMV
• Tag / Fusion Protein:
  • Flag (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: Not I (not destroyed)
• 5′ sequencing primer: T7 FWD TAATACGACTCACTATAGGG
• 3′ sequencing primer: BGH Rev CCTCGACTGTGCCTTCTA

Resource Information

• A portion of this plasmid was derived from a plasmid made by: (EGFP)-PTP1B-HA construct was a gift from C. Arregui (University of San Martin, Buenos Aires, Argentina)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

A Kozak methionine initiator sequence and a Flag tag were added to the N terminus of rat PTP1B, which was amplified by PCR with the following primers: 5′-CTCGGATCCGCCACCATGGACTACAAGGACGACGATGACAAGAAGCTTGGGATGGAAATGGAGAAGGAATTCGAG-3′ and 5′-CTCTAGACTCGAGCGGCCGCTCAGTGAAAACATACCCGGTAACAG-3′. The PCR product was digested with BamHI and NotI and subsequently ligated into the corresponding sites of pCDNA3.1(+) (Invitrogen)

Please note that Addgene's sequencing results differ from the full plasmid sequence information from the depositing laboratory at bp# 889-910, indicating that the NheI and AflII sites are no longer present in the plasmid.

DNA (Catalog # 35988-D50)

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

• Amount: 50 μg
• Concentration: 1 μg/μL
• Pricing: $495 USD
• Storage: 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

DNA (Catalog # 35988-D100)

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

• Amount: 100 μg
• Concentration: 1 μg/μL
• Pricing: $585 USD
• Storage: 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.