pEGFP-Sec16A
(Plasmid #36155)

• Purpose: Expresses Sec16A as a GFP fusion
• Depositing Lab: David Stephens
• Depositing Organization: University of Bristol
  Located in United Kingdom of Great Britain and Northern Ireland
• Publication: Watson et al Traffic. 2006 Dec;7(12):1678-87. Epub 2006 Sep 27.
• Citations: 5 Articles

Backbone

• Vector backbone: pEGFP-C1
• Backbone manufacturer: Clontech
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Stbl3
• Growth instructions: Difficult to grow and prep without apparent loss of some of insert.
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Sec16A
• Alt name: KIAA0310
• Species: H. sapiens (human)
• Entrez Gene: SEC16A (a.k.a. KIAA0310, SEC16L, p250)
• Promoter: CMV
• Tag / Fusion Protein:
  • EGFP (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BglII (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: GGGGAGATCTATGCAGCCACCGCCCCAGACGG
• 3′ sequencing primer: GGGGGAATTCTCAGTTCAGCACCAGGTGCTTCC

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Original insert from Kasuza as detailed in the attachment. Cloned by Peter Watson, now at University of Cardiff when he was a postdoc in the lab.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please note: Plasmid contains a D1555N mutation in Sec16A compared to the NCBI reference sequence NP_055681.1, this mutation is not known to affect plasmid function.

DNA (Catalog # 36155-D50)

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

• Amount: 50 μg
• Concentration: 1 μg/μL
• Pricing: $495 USD
• Storage: 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

DNA (Catalog # 36155-D100)

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

• Amount: 100 μg
• Concentration: 1 μg/μL
• Pricing: $585 USD
• Storage: 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.