pUC19-HHtRNA
(Plasmid
#37222)
-
Depositing Lab
-
Depositing OrganizationJohns Hopkins University and School of Medicine
Located in United States of America -
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 37222 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepUC19
- Backbone size w/o insert (bp) 2686
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameHHtRNA
-
SpeciesS. cerevisiae (budding yeast)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SmaI (unknown if destroyed)
- 3′ cloning site BamHI (unknown if destroyed)
- 5′ sequencing primer M13pUC-F
- 3′ sequencing primer M13-pUC-Rev
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
HHtRNA sequence (rev orientation): TGGTAGCGCCGCTCGGTTTCGATCCGAGGACATCAGGGTTATGAGCCCTGCGCGCTTCCACTGCGCCACGGCGCTGACGGTACCGGGTACCGTTTCGTCCTCACGGACTCATCAGAGCG
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pUC19-HHtRNA was a gift from Jon Lorsch (Addgene plasmid # 37222 ; http://n2t.net/addgene:37222 ; RRID:Addgene_37222) -
For your References section:
Reconstitution of yeast translation initiation. Acker MG, Kolitz SE, Mitchell SF, Nanda JS, Lorsch JR. Methods Enzymol. 2007;430:111-45. 10.1016/S0076-6879(07)30006-2 PubMed 17913637