Skip to main content

pNCMV 11E6
(Plasmid #37455)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 37455 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 37455-D50 50 μg of DNA in Tris buffer $495
DNA 37455-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    CMV bam neo
  • Backbone size w/o insert (bp) 6550
  • Total vector size (bp) 7080
  • Modifications to backbone
    Flag/HA tag-containing linker added at BamHI site.
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    HPV 11E6
  • Alt name
    E6
  • Species
    HPV
  • Insert Size (bp)
    530
  • Promoter CMV
  • Tags / Fusion Proteins
    • Flag (N terminal on backbone)
    • HA (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site BamHI (destroyed during cloning)
  • 5′ sequencing primer Bglob_intron_F (ctggtcatcatcctgccttt)
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pNCMV 11E6 was a gift from Karl Munger (Addgene plasmid # 37455 ; http://n2t.net/addgene:37455 ; RRID:Addgene_37455)
  • For your References section:

    Activation of cap dependent translation by mucosal Human Papillomavirus E6 proteins is dependent on the integrity of the LXXLL binding motif. Spangle J, Ghosh-Choudhury N, Munger K. J Virol. 2012 May 2. 10.1128/JVI.00487-12 PubMed 22553330