-
Depositing Lab
-
Depositing OrganizationUniversity of Tokyo, Graduate School of Medicine
Located in Japan -
Publication
-
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 38272 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepMXs-IP
-
Backbone manufacturerDr. Toshio Kitamura of the University of Tokyo
- Backbone size w/o insert (bp) 5800
- Total vector size (bp) 6800
-
Vector typeMammalian Expression, Retroviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameWD repeat domain phosphoinositide-interacting protein 1
-
Alt nameWIPI-1
-
Alt nameWIPI49
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1300
-
GenBank IDAK000917
-
Entrez GeneWIPI1 (a.k.a. ATG18, ATG18A, WIPI49)
-
Tag
/ Fusion Protein
- EGFP (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer CGACCACTACCAGCAGAACA
- 3′ sequencing primer GAGGAACTGCTTCCTTCACG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMXs-IP GFP-WIPI-1 was a gift from Noboru Mizushima (Addgene plasmid # 38272 ; http://n2t.net/addgene:38272 ; RRID:Addgene_38272) -
For your References section:
Characterization of autophagosome formation site by a hierarchical analysis of mammalian Atg proteins. Itakura E, Mizushima N. Autophagy. 2010 Aug;6(6):764-76. 10.4161/auto.6.6.12709 PubMed 20639694