Skip to main content
Addgene
Open Menu

pPac-PL-mCD8-D2A-Gal4
(Plasmid #39457)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 39457 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Add to Cart
DNA 39457-D50 50 μg of DNA in Tris buffer $495
Add to Cart
DNA 39457-D100 100 μg of DNA in Tris buffer $585
Add to Cart

Backbone

  • Vector backbone
    pPac-PL
  • Backbone size w/o insert (bp) 6392
  • Total vector size (bp) 9777

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    mCD8-D2A-Gal4
  • Promoter actin

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site none (destroyed during cloning)
  • 3′ cloning site NotI (unknown if destroyed)
  • 5′ sequencing primer AGTCGTCTAATCCAGAGACC
  • 3′ sequencing primer GATCTTGATCTTCATGGTCG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pPac-PL-mCD8-D2A-Gal4 was a gift from Benjamin White (Addgene plasmid # 39457 ; http://n2t.net/addgene:39457 ; RRID:Addgene_39457)

  • For your References section:

    A novel approach for directing transgene expression in Drosophila: T2A-Gal4 in-frame fusion. Diao F, White BH. Genetics. 2012 Mar;190(3):1139-44. Epub 2011 Dec 29. 10.1534/genetics.111.136291 PubMed 22209908
Related items: