-
Depositing Lab
-
Depositing OrganizationWhitehead Institute for Biomedical Research
Located in United States of America -
Publication
-
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 40644 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepLKO.1 puro (Addgene plasmid 8453)
-
Backbone manufacturerWeinberg lab
- Backbone size w/o insert (bp) 7032
-
Vector typeMammalian Expression, Lentiviral, RNAi
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namesh-hSOX9-1
-
Alt nameSox9
-
Alt nameshRNA against human Sox9
-
gRNA/shRNA sequenceGCATCCTTCAATTTCTGTATA
-
SpeciesH. sapiens (human)
-
GenBank IDRHS3979-9587792 (Open Biosystems); NM_000346
-
Entrez GeneSOX9 (a.k.a. CMD1, CMPD1, ENH13, SRA1, SRXX2, SRXY10, TESCO)
- Promoter hU6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (unknown if destroyed)
- 3′ cloning site EcoRI (unknown if destroyed)
- 5′ sequencing primer LKO.1 5'
- (Common Sequencing Primers)
Resource Information
-
Reference
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLKO.1-sh-hSOX9-1 was a gift from Bob Weinberg (Addgene plasmid # 40644 ; http://n2t.net/addgene:40644 ; RRID:Addgene_40644) -
For your References section:
Slug and Sox9 cooperatively determine the mammary stem cell state. Guo W, Keckesova Z, Donaher JL, Shibue T, Tischler V, Reinhardt F, Itzkovitz S, Noske A, Zurrer-Hardi U, Bell G, Tam WL, Mani SA, van Oudenaarden A, Weinberg RA. Cell. 2012 Mar 2;148(5):1015-28. 10.1016/j.cell.2012.02.008 PubMed 22385965