pAS-7 (mm12-21)
(Plasmid
#40842)
-
PurposeTarget RNAs used to determine complementarity requirements for in vitro tailing and degradation
-
Depositing Lab
-
Depositing OrganizationUniversity of Massachusetts, Worcester
Located in the United States of America -
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 40842 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepENTR/D-EGFP
-
Backbone manufacturerZamore lab
- Total vector size (bp) 3549
-
Modifications to backboneA DNA fragment encoding EGFP together with the downstream multiple cloning site was amplified from pEGFP-N1 (Clontech, Mountain View, CA, USA) and inserted into pENTR/D-TOPO (Invitrogen, Carlsbad, CA, USA) using the pENTR Directional TOPO Cloning Kit (Invitrogen) to generate pENTR/D-EGFP.
-
Vector typeInsect Expression ; miRNA reporter
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namelet-7–mm12-21
-
SpeciesD. melanogaster (fly)
- Promoter Actin5C
-
Tag
/ Fusion Protein
- EGFP (N terminal on insert)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer EGFP-C
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The let-7 mm12-21 complimentary sequence was inserted in the XbaI site in the 3'UTR of EGFP using the following oligos:
s: CTAGATGCCATGTTGCTACTACCTCAT
as: CTAGATGAGGTAGTAGCAACATGGCAT
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAS-7 (mm12-21) was a gift from Phillip Zamore (Addgene plasmid # 40842 ; http://n2t.net/addgene:40842 ; RRID:Addgene_40842) -
For your References section:
Target RNA-directed trimming and tailing of small silencing RNAs. Ameres SL, Horwich MD, Hung JH, Xu J, Ghildiyal M, Weng Z, Zamore PD. Science. 2010 Jun 18;328(5985):1534-9. 10.1126/science.1187058 PubMed 20558712
Map uploaded by the depositor.