This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pMpGWB102-Citrine-PTS1
(Plasmid #44592)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 44592 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pMpGWB102
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 10404
  • Total vector size (bp) 11130
  • Modifications to backbone
    These PCR-amplified DNA fragments of Citrine-PTS1 were cloned into a pDONR207 plasmid by BP reaction (Invitrogen). The resulting plasmids were mixed with pMpGWB102 vector, and LR reaction (Invitrogen) was performed to generate pMpGWB102-Citrine-PTS1.
  • Vector type
    Plant Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Spectinomycin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Citrine-PTS1
  • Species
    Synthetic
  • Insert Size (bp)
    729
  • Promoter CaMV 35S promoter
  • Tag / Fusion Protein
    • PTS1 (peroxisomal targeting signal type 1) (C terminal on insert)

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer GGGGACAAGTTTGTACAAAAAAGCAGGCTCCATGGTGAGCAAGGGCGAG
  • 3′ sequencing primer GGGGACCACTTTGTACAAGAAAGCTGGGTCTCACAACTTGGACTTGTACAG CTCGTCC
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMpGWB102-Citrine-PTS1 was a gift from Yutaka Kodama (Addgene plasmid # 44592 ; http://n2t.net/addgene:44592 ; RRID:Addgene_44592)
  • For your References section:

    Cold-induced organelle relocation in the liverwort Marchantia polymorpha L. Ogasawara Y, Ishizaki K, Kohchi T, Kodama Y. Plant Cell Environ. 2013 Feb 20. doi: 10.1111/pce.12085. 10.1111/pce.12085 PubMed 23421791