-
Depositing Labs
-
Depositing OrganizationOregon Health & Science University
Located in United States of America -
Publication
-
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 45059 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 45059-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 45059-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepBa-eGFP
- Backbone size w/o insert (bp) 6755
- Total vector size (bp) 8410
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameKif5c
-
Alt nameKif5c560
-
Alt namekinesin family member 5C
-
SpeciesR. norvegicus (rat)
-
Insert Size (bp)1676
-
Mutationmotor domain aa1-559
-
GenBank IDNM_001107730.1
-
Entrez GeneKif5c
- Promoter Chicken Beta Actin
-
Tag
/ Fusion Protein
- GFP (C terminal on backbone)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer TTCGGCTTCTGGCGTGTGAC
- 3′ sequencing primer GTGGTTTGTCCAAACTCATC
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byKif 5c received from Bruce Schnapp, Oregon Health & Science University
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
pBa vector is susceptable to recombination and should not be grown in fast growing bacteria or cloned using recombination.
XL 10-Gold, Stbl3, OmniMax2, DH5alpha, and XL 1-Blue are suitable growth strains.
DNA (Catalog # 45059-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 45059-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBa.Kif5c 1-559.GFP was a gift from Gary Banker & Marvin Bentley (Addgene plasmid # 45059 ; http://n2t.net/addgene:45059 ; RRID:Addgene_45059) -
For your References section:
A change in the selective translocation of the Kinesin-1 motor domain marks the initial specification of the axon. Jacobson C, Schnapp B, Banker GA. Neuron. 2006 Mar 16;49(6):797-804. 10.1016/j.neuron.2006.02.005 PubMed 16543128