-
Depositing Lab
-
Depositing OrganizationNational Institute of Neurological Disorders and Strokes (NINDS)
Located in United States of America -
Publication
-
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 45160 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 45160-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 45160-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepEYFP-C1
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 4706
- Total vector size (bp) 6806
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameDrp1
-
Alt nameDynamin related protein 1
-
Alt nameDNM1L
-
Alt nameDLP1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2100
-
GenBank IDNM_005690
-
Entrez GeneDNM1L (a.k.a. DLP1, DRP1, DVLP, DYMPLE, EMPF, EMPF1, HDYNIV, OPA5)
- Promoter CMV
-
Tag
/ Fusion Protein
- EYFP (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcorI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer AGAAGCGCGATCACATGG
- 3′ sequencing primer CTACAAATGTGGTATGGCTG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 45160-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 45160-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEYFP-C1-Drp1 was a gift from Richard Youle (Addgene plasmid # 45160 ; http://n2t.net/addgene:45160 ; RRID:Addgene_45160) -
For your References section:
The role of dynamin-related protein 1, a mediator of mitochondrial fission, in apoptosis. Frank S, Gaume B, Bergmann-Leitner ES, Leitner WW, Robert EG, Catez F, Smith CL, Youle RJ. Dev Cell. 2001 Oct;1(4):515-25. 10.1016/S1534-5807(01)00055-7 PubMed 11703942