pCRII-Topo Tcrb-V13 in situ probe
(Plasmid
#45622)
-
Depositing Lab
-
Depositing OrganizationHarvard University
Located in United States of America -
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 45622 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepCRII-Topo
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 4000
- Total vector size (bp) 4500
-
Vector typein situ
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameTcrb-V13 in situ probe
-
Alt nameT cell receptor beta chain
-
Alt nameTcrB
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)527
-
Mutationfragment contains bp# 533-1058 of X67128
-
GenBank ID
-
Entrez GeneTcrb (a.k.a. TCRbeta, Tib)
Cloning Information
- Cloning method TOPO Cloning
- 5′ sequencing primer M13 Rev, Sp6
- 3′ sequencing primer T7, M13 Forward
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The Tcrb-V13 fragment was amplified by RT-PCR using the following primer pair:
CTGAGCTGGTGGGTGAATG
AAGGTGTCAACGAGGAAGGA
For in vitro transcription, use the NotI restriction digest and Sp6 promoter for sense probe generation and the HindIII restriction digest and T7 promoter for antisense probe generation.
Please note that Addgene's sequencing results match bp# 533-1058 of X67128, not bp# 532-1059 as indicated on plasmid map. The plasmid functions as described in the associated publication.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCRII-Topo Tcrb-V13 in situ probe was a gift from Jeffrey Macklis (Addgene plasmid # 45622 ; http://n2t.net/addgene:45622 ; RRID:Addgene_45622) -
For your References section:
Fezl is required for the birth and specification of corticospinal motor neurons. Molyneaux BJ, Arlotta P, Hirata T, Hibi M, Macklis JD. Neuron. 2005 Sep 15;47(6):817-31. 10.1016/j.neuron.2005.08.030 PubMed 16157277
Map uploaded by the depositor.