Skip to main content

pcDNA3-FLAG-HA-CAD S1859A
(Plasmid #46239)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 46239 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 46239-D50 50 μg of DNA in Tris buffer $495
DNA 46239-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pcDNA3
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 5500
  • Total vector size (bp) 12345
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    carbamoyl-phosphate synthetase 2, aspartate transcarbamylase, and dihydroorotase
  • Alt name
    CAD
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    6943
  • Mutation
    Serine 1859 changed to Alanine (S1859A)
  • GenBank ID
    NM_023525
  • Entrez Gene
    Cad (a.k.a. 2410008J01Rik, AU018859, Cpad)
  • Promoter cmv
  • Tags / Fusion Proteins
    • FLAG (N terminal on insert)
    • HA (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRV (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer CMV-F
  • 3′ sequencing primer tgctgatgtcattgtgctccga
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA3-FLAG-HA-CAD S1859A was a gift from Brendan Manning (Addgene plasmid # 46239 ; http://n2t.net/addgene:46239 ; RRID:Addgene_46239)
  • For your References section:

    Stimulation of de novo pyrimidine synthesis by growth signaling through mTOR and S6K1. Ben-Sahra I, Howell JJ, Asara JM, Manning BD. Science. 2013 Mar 15;339(6125):1323-8. doi: 10.1126/science.1228792. Epub 2013 Feb 21. 10.1126/science.1228792 PubMed 23429703