pFA12
(Plasmid
#46792)
-
PurposeTo express a version of Fun30 with a mutated CUE domain in budding yeast
-
Depositing Lab
-
Depositing OrganizationBabraham Institute
Located in United Kingdom of Great Britain and Northern Ireland -
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 46792 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepYES2.1/V5-His/lacZ
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 8964
- Total vector size (bp) 12690
-
Modifications to backboneThe vector used for galactose-induced yeast expression of C-terminal double tagged (V5 and 6xHis) proteins was the pYES2.1/V5-His-TOPO (Invitrogen) and cloning was according to the manufacturer’s specifications. The identity of the cloned material was confirmed by restriction digestion analysis and DNA sequencing. PFA1 contains the full-length wild-type Fun30 sequence. The coding region of Fun30, including the 2 codons immediately upstream of the sequence and excluding the stop codon were amplified by polymerase chain reaction (PCR) from purified genomic DNA using the enzyme PfuUltra (Stratagene) following the manufacturer’s specifications. The primers used were: forward F30 (GTCGACGAAAACATGAGTGGTTCG) and reverse F30 (CTCGAGTTCTTTGGTTCCCTTCGG), which introduced a SalI and an XhoI restriction enzyme sites in the fragment amplified, in the 5’- and 3’- ends, respectively. 3’adenylation of the amplified fragments was done by PCR, after which the TOPO cloning reaction was performed. PFA12 contains a version of Fun30 in which the residues that have been shown to bind ubiquitin in the Cue domain (Donaldson et al., 2003; Shih et al., 2003) have been mutated: phenylalanine at position 82 (TTC) and proline at position 83 (CCC) have both been replaced by residues of alanine (GCC). The point mutations were introduced with the kit QuickChange XL Site-Directed Mutagenesis (Stratagene), according to the manufacturer’s specifications. The template was PFA1 and the primers were Forward PMut Cue (GTTAACCTTGCGAGAGAGGCCGCCGATTTCTCTCAAAC) and Reverse PMut Cue (GTTTGAGAGAAATCGGCGGCCTCTCTCGCAAGGTTAAC).
-
Vector typeYeast Expression
-
Selectable markersURA3
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Top10
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameFUN30, CUE domain mutated
-
Alt nameYAL019W
-
SpeciesS. cerevisiae (budding yeast)
-
MutationFP82AA
-
Entrez GeneFUN30 (a.k.a. YAL019W)
-
Tag
/ Fusion Protein
- V5 (C terminal on backbone)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pFA12 was a gift from Patrick Varga-Weisz (Addgene plasmid # 46792 ; http://n2t.net/addgene:46792 ; RRID:Addgene_46792) -
For your References section:
The SNF2-family member Fun30 promotes gene silencing in heterochromatic loci. Neves-Costa A, Will WR, Vetter AT, Miller JR, Varga-Weisz P. PLoS One. 2009 Dec 1;4(12):e8111. doi: 10.1371/journal.pone.0008111. 10.1371/journal.pone.0008111 PubMed 19956593