Skip to main content

nes1852tk/lacZ
(Plasmid #47613)

Full plasmid sequence is not available for this item.

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 47613 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 47613-D50 50 μg of DNA in Tris buffer $495
DNA 47613-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    SaStk/lacZ
  • Backbone manufacturer
    Clontech; modified by Lendahl lab
  • Modifications to backbone
    removed SalI site from pTKbeta and replaced HSV tk promoter with a basic HSV tk promoter containing SalI site.
  • Vector type
    enhancer reporter

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    XL1 Blue
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    nestin 2nd intron
  • Alt name
    NES
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1852
  • Mutation
    2nd intron only
  • Entrez Gene
    NES (a.k.a. Nbla00170)
  • Promoter HSV tk promoter
  • Tags / Fusion Proteins
    • HSV tk promoter (C terminal on backbone)
    • lacZ (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SalI (not destroyed)
  • 3′ cloning site SalI (not destroyed)
  • 5′ sequencing primer SaStk/lacZ 5 (gtcggggctggcttaactat)
  • 3′ sequencing primer LacZ-R
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

HindIII cleavage excises the complete enhancer-tk promoter-lacZ fragment from the vector. The lacZ gene can be removed from the SaStk/lacZ vector after cleavage with NotI.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    nes1852tk/lacZ was a gift from Urban Lendahl (Addgene plasmid # 47613 ; http://n2t.net/addgene:47613 ; RRID:Addgene_47613)
  • For your References section:

    An evolutionarily conserved region in the second intron of the human nestin gene directs gene expression to CNS progenitor cells and to early neural crest cells. Lothian C, Lendahl U. Eur J Neurosci. 1997 Mar;9(3):452-62. 10.1111/j.1460-9568.1997.tb01622.x PubMed 9104587