nes1852tk/lacZ
(Plasmid
#47613)
-
Purposeused to create transgenic mice expressing LacZ reporter with Nestin enhancer
-
Depositing Lab
-
Depositing OrganizationKarolinska Institutet
Located in Sweden -
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 47613 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 47613-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 47613-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backboneSaStk/lacZ
-
Backbone manufacturerClontech; modified by Lendahl lab
-
Modifications to backboneremoved SalI site from pTKbeta and replaced HSV tk promoter with a basic HSV tk promoter containing SalI site.
-
Vector typeenhancer reporter
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)XL1 Blue
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namenestin 2nd intron
-
Alt nameNES
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1852
-
Mutation2nd intron only
-
Entrez GeneNES (a.k.a. Nbla00170)
- Promoter HSV tk promoter
-
Tags
/ Fusion Proteins
- HSV tk promoter (C terminal on backbone)
- lacZ (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SalI (not destroyed)
- 3′ cloning site SalI (not destroyed)
- 5′ sequencing primer SaStk/lacZ 5 (gtcggggctggcttaactat)
- 3′ sequencing primer LacZ-R
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
HindIII cleavage excises the complete enhancer-tk promoter-lacZ fragment from the vector. The lacZ gene can be removed from the SaStk/lacZ vector after cleavage with NotI.
DNA (Catalog # 47613-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 47613-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
nes1852tk/lacZ was a gift from Urban Lendahl (Addgene plasmid # 47613 ; http://n2t.net/addgene:47613 ; RRID:Addgene_47613) -
For your References section:
An evolutionarily conserved region in the second intron of the human nestin gene directs gene expression to CNS progenitor cells and to early neural crest cells. Lothian C, Lendahl U. Eur J Neurosci. 1997 Mar;9(3):452-62. 10.1111/j.1460-9568.1997.tb01622.x PubMed 9104587
Map uploaded by the depositor.