Skip to main content

pMT3-FLAG-KLF3
(Plasmid #49102)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 49102 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 49102-D50 50 μg of DNA in Tris buffer $495
DNA 49102-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pMT3
  • Backbone size w/o insert (bp) 5100
  • Total vector size (bp) 1035
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Krüppel-Like Factor 3(KLF3)
  • Alt name
    BKLF
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    1035
  • GenBank ID
    NC_000071.6
  • Tag / Fusion Protein
    • FLAG (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (destroyed during cloning)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer GACAATGACATCCACTTTGC
  • 3′ sequencing primer CGTCAAGTTTGGCGCGAAAT
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMT3-FLAG-KLF3 was a gift from Merlin Crossley (Addgene plasmid # 49102 ; http://n2t.net/addgene:49102 ; RRID:Addgene_49102)
  • For your References section:

    KLF3 regulates muscle-specific gene expression and synergizes with serum response factor on KLF binding sites. Himeda CL, Ranish JA, Pearson RC, Crossley M, Hauschka SD. Mol Cell Biol. 2010 Jul;30(14):3430-43. doi: 10.1128/MCB.00302-10. Epub 2010 Apr 19. 10.1128/MCB.00302-10 PubMed 20404088