pmirGLO-Bmpr2-1719
(Plasmid
#49379)
-
PurposeInsert is a fragment of the Bmpr2 3'-UTR that contains miR-17 and miR-19 binding sites. To be used for 3'UTR assay.
-
Depositing Lab
-
Depositing OrganizationSt. Jude Children's Research Hospital
Located in the United States of America -
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 49379 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 49379-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 49379-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepmirGLO
-
Backbone manufacturerPromega
- Backbone size w/o insert (bp) 7350
- Total vector size (bp) 7377
-
Modifications to backboneFor cloning oligonucleotides into pmirGLO, bp 7314-7331 were excised (region between PmeI and XbaI).
-
Vector typeLuciferase
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsN/A
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameBmpr2
-
SpeciesH. sapiens (human), M. musculus (mouse)
-
Insert Size (bp)45
-
GenBank IDNM_001204
-
Entrez GeneBMPR2 (a.k.a. BMPR-II, BMPR3, BMR2, BRK-3, POVD1, PPH1, T-ALK)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site PmeI (not destroyed)
- 3′ cloning site XbaI (not destroyed)
- 5′ sequencing primer GAAGCTGAGTTGGCTGCT
- 3′ sequencing primer CACTGCATTCTAGTTGTGGT
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 49379-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 49379-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pmirGLO-Bmpr2-1719 was a gift from Martine Roussel (Addgene plasmid # 49379 ; http://n2t.net/addgene:49379 ; RRID:Addgene_49379) -
For your References section:
Silencing of the miR-17~92 cluster family inhibits medulloblastoma progression. Murphy BL, Obad S, Bihannic L, Ayrault O, Zindy F, Kauppinen S, Roussel MF. Cancer Res. 2013 Oct 21. 10.1158/0008-5472.CAN-13-0927 PubMed 24145352