Skip to main content

EGFP-Rab14
(Plasmid #49549)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 49549 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    EGFP C1
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 4700
  • Total vector size (bp) 5360
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Rab14
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    660
  • GenBank ID
    AF498949
  • Entrez Gene
    RAB14 (a.k.a. FBP, RAB-14)
  • Promoter CMV
  • Tag / Fusion Protein
    • EGFP (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI/BglII (destroyed during cloning)
  • 3′ cloning site XhoI/SalI (destroyed during cloning)
  • 5′ sequencing primer EGFP C (CATGGTCCTGCTGGAGTTCGTG)
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Rab14 cDNA derived from pCDNA3.1+Rab14 purchased from Missouri S&T cDNA Resource Center

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    EGFP-Rab14 was a gift from Marci Scidmore (Addgene plasmid # 49549)
  • For your References section:

    The Anaplasma phagocytophilum-occupied vacuole selectively recruits Rab-GTPases that are predominantly associated with recycling endosomes. Huang B, Hubber A, McDonough JA, Roy CR, Scidmore MA, Carlyon JA. Cell Microbiol. 2010 Sep 1;12(9):1292-307. doi: 10.1111/j.1462-5822.2010.01468.x. Epub 2010 Mar 25. 10.1111/j.1462-5822.2010.01468.x PubMed 20345488