Skip to main content

EGFP-Rab11AQ70L
(Plasmid #49553)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 49553 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    EGFP C2
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 4700
  • Total vector size (bp) 5360
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Rab11A
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    600
  • Mutation
    Glutamine 70 to Leucine
  • GenBank ID
    AF498946
  • Entrez Gene
    RAB11A (a.k.a. YL8)
  • Promoter CMV
  • Tag / Fusion Protein
    • EGFP (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site XhoI/SalI (destroyed during cloning)
  • 5′ sequencing primer EGFP C (CATGGTCCTGCTGGAGTTCGTG)
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Rab11A cDNA derived from pGreenLatern-Rab11A (original creator unknown)
  • Articles Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    EGFP-Rab11AQ70L was a gift from Marci Scidmore (Addgene plasmid # 49553)
  • For your References section:

    Chlamydia pneumoniae inclusion membrane protein Cpn0585 interacts with multiple Rab GTPases. Cortes C, Rzomp KA, Tvinnereim A, Scidmore MA, Wizel B. Infect Immun. 2007 Dec;75(12):5586-96. Epub 2007 Oct 1. 10.1128/IAI.01020-07 PubMed 17908815