-
Purposeexpresses EGFP-Rab18Q67L in mammalian cells
-
Depositing Lab
-
Depositing OrganizationCornell University
Located in United States of America -
Publication
-
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 49596 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backboneEGFP C1
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 4700
- Total vector size (bp) 5300
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameRab18Q67L
-
SpeciesH. sapiens (human)
-
Insert Size (bp)600
-
MutationGlutamine 67 to Leucine
-
GenBank IDAF498950
-
Entrez GeneRAB18 (a.k.a. RAB18LI1, WARBM3)
- Promoter CMV
-
Tag
/ Fusion Protein
- EGFP (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI/BglII (destroyed during cloning)
- 3′ cloning site XhoI/SalI (destroyed during cloning)
- 5′ sequencing primer EGFP C (CATGGTCCTGCTGGAGTTCGTG)
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byRab18 derived from pDNA3.1+Rab18 purchased from Missours S&T cDNA Resource Center
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
EGFP-Rab18Q67L was a gift from Marci Scidmore (Addgene plasmid # 49596)