pFF19
(Plasmid
#49777)
-
Purpose(Empty Backbone) plant expression cassette
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 49777 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepUC120
- Backbone size (bp) 4200
-
Modifications to backbone658 bp HincII-BglII fragnent from the CaMV strain CM1841 (the regulatory region from cauliflower mosaic virus) was cloned into the HincII-BamHI sites from pUC120. This was mutated to create unique XhoI site (7474). The flanking SstI, KpnI and SmaI sites were deleted by digestion with SstI and SmaI, Klenow treatment, and religation to make pFF12. Similarly, the HincII, PstI, and SphI sites were deleted to make pFF14. The 35S enhancer was duplicated by inserting the EcoRV-HindIII fragment from pFF14 into HincII-HindIII sites of pFF12. Then a polylinker was inserted as a mung bean nuclease treated HindIII fragment into the XhoI site which was filled in with Klenow fragment.
-
Vector typePlant expression
- Promoter cauliflower mosaic virus (CaMV)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer 35 S promoter (CTATCCTTCGCAAGACCCTTC)
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
polylinker sites: SphI, PstI, SalI, XbaI, BamHI, SmaI, KpnI, SstI/SacI, NruI
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pFF19 was a gift from Joachim Messing (Addgene plasmid # 49777 ; http://n2t.net/addgene:49777 ; RRID:Addgene_49777) -
For your References section:
The pFF plasmids: cassettes utilising CaMV sequences for expression of foreign genes in plants. Timmermans MC, Maliga P, Vieira J, Messing J. J Biotechnol. 1990 Jun;14(3-4):333-44. 10.1016/0168-1656(90)90117-T PubMed 1369289
Map uploaded by the depositor.