-
Purposeexpresses an attenuated T7 RNAP under an isopropyl β-d-1-thiogalactopyranoside (IPTG) inducible control
-
Depositing Lab
-
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 49990 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepIncW
-
Modifications to backbonePlasmid pIncW (pSa, SpR) was generated from pEXT21 (pSa,SpR) by deletion of osa, nuc1, the Tn21 integrase gene, and ORF18 (Temme, et al. PNAS 2012, PMID 22509035).
-
Vector typeBacterial Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH10B
-
Growth instructionsPlasmid is maintained at only 2-3 copies/cells, so it is difficult to sequence from minipreps (better to use PCR).
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameT7 RNAP*
-
Alt nameattenuated T7 RNAP
-
SpeciesBacteriophage T7
-
MutationR632S
- Promoter pTac-symmetric
-
Tag
/ Fusion Protein
- umuD degradation tag (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site unknown (unknown if destroyed)
- 3′ cloning site unknown (unknown if destroyed)
- 5′ sequencing primer aaggcgcactcccgttctgg
- 3′ sequencing primer attaccgcctttgagtgagc
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
CDS of the T7 RNAP starts with the GTG at the beginning of the sequence.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pN565 was a gift from Christopher Voigt (Addgene plasmid # 49990 ; http://n2t.net/addgene:49990 ; RRID:Addgene_49990) -
For your References section:
Design of orthogonal genetic switches based on a crosstalk map of sigmas, anti-sigmas, and promoters. Rhodius VA, Segall-Shapiro TH, Sharon BD, Ghodasara A, Orlova E, Tabakh H, Burkhardt DH, Clancy K, Peterson TC, Gross CA, Voigt CA. Mol Syst Biol. 2013 Oct 29;9:702. doi: 10.1038/msb.2013.58. 10.1038/msb.2013.58 PubMed 24169405