pBUN411
(Plasmid #50581)

• Purpose: CRISPR/Cas based plant genome editing and gene regulation; expresses 3×FLAG-NLS-zCas9-NLS, gRNA scaffold for insertion of target sequence (OsU3 promoter), Bar resistance
• Depositing Lab: Qi-Jun Chen
• Depositing Organization: China Agricultural University
  Located in China
• Publication: Xing et al BMC Plant Biol. 2014 Nov 29;14(1):327.
• Citations: 2 Articles

Backbone

• Vector backbone: pGreen-like binary vector
• Backbone manufacturer: Mullineaux Lab, see http://www.pgreen.ac.uk/
• Vector type: CRISPR ; Plant expression
• Selectable markers: Bar

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin and Spectinomycin, 50 & 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: 3×FLAG-NLS-zCas9-NLS
• Alt name: Cas9
• Species: Synthetic
• Mutation: maize codon optimized
• Promoter: Ubi1p
• Tags / Fusion Proteins:
  • 3xFLAG (N terminal on insert)
  • NLS (N terminal on insert)
  • NLS (C terminal on insert)

Cloning Information for Gene/Insert 1

• Cloning method: Unknown
• 5′ sequencing primer: hSpCas9-R1, CGCTCGTGCTTCTTATCCTC

Gene/Insert 2

• Gene/Insert name: gRNA scaffold
• Species: Synthetic
• Promoter: OsU3p

Cloning Information for Gene/Insert 2

• Cloning method: Unknown
• 5′ sequencing primer: RB-F1, ggataaaccttttcacgccc

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

DNA (Catalog # 50581-D50)

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

• Amount: 50 μg
• Concentration: 1 μg/μL
• Pricing: $495 USD
• Storage: 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

DNA (Catalog # 50581-D100)

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

• Amount: 100 μg
• Concentration: 1 μg/μL
• Pricing: $585 USD
• Storage: 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.