pET20b- hTPI Ile170Thr
(Plasmid
#50725)
-
Purposeoverexpression of the human TPI1 Ile170Thr allele in E.coli
-
Depositing Lab
-
Depositing OrganizationUniversity of Cambridge
Located in the United Kingdom of Great Britain and Northern Ireland -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 50725 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepET20b
- Backbone size w/o insert (bp) 3591
- Total vector size (bp) 4340
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTriosephosphate isomerase 1
-
Alt nameTPI1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)747
-
Mutationchanged Isoleucine 170 to Threonine
-
GenBank IDNM_000365.5
-
Entrez GeneTPI1 (a.k.a. HEL-S-49, TIM, TPI, TPID)
- Promoter T7
-
Tag
/ Fusion Protein
- 6xHIS tag (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NdeI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer T7 (TAATACGACTCACTATAGGG)
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pET20b- hTPI Ile170Thr was a gift from Markus Ralser (Addgene plasmid # 50725 ; http://n2t.net/addgene:50725 ; RRID:Addgene_50725) -
For your References section:
Inhibition of triosephosphate isomerase by phosphoenolpyruvate in the feedback-regulation of glycolysis. Gruning NM, Du D, Keller MA, Luisi BF, Ralser M. Open Biol. 2014 Mar 5;4(3):130232. doi: 10.1098/rsob.130232. 10.1098/rsob.130232 PubMed 24598263