Skip to main content
Addgene
Open Menu

pCMV6-AC-GFP-C-term-astrin-frag. (482-1193)
(Plasmid #51122)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 51122 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pCMV6-AC-GFP
  • Backbone manufacturer
    OriGene Technologies Inc.
  • Backbone size w/o insert (bp) 6547
  • Total vector size (bp) 8692
  • Modifications to backbone
    Restriction enzyme digest with AsisI and MluI reveals 43 bp fragment from the backbone. The 43 bp fragment contains a HindIII restriction site. Restriction sites NotI and AvaI in the backbone are deleted (15bp, pos.4614-4628bp)
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DB3.1
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    astrin C-terminal coiled-coil domains 482-1193aa
  • Alt name
    Spag5
  • Alt name
    Astrin
  • Alt name
    Mitotic spindle-associated protein p126
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2145
  • GenBank ID
    NM_006461.3
  • Entrez Gene
    SPAG5 (a.k.a. DEEPEST, MAP126, hMAP126)
  • Tag / Fusion Protein
    • tGFP (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Asis I (not destroyed)
  • 3′ cloning site Mlu I (not destroyed)
  • 5′ sequencing primer CGGTGGGAGGTCTATATAAGC
  • 3′ sequencing primer TTTTACGCGTgctcagaaattccagcaatccct
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    astrin was derived from pCMV6entry-Spag5 (RC201783, OriGene Technologies Inc.)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCMV6-AC-GFP-C-term-astrin-frag. (482-1193) was a gift from Kathrin Thedieck (Addgene plasmid # 51122)

  • For your References section:

    Inhibition of mTORC1 by astrin and stress granules prevents apoptosis in cancer cells. Thedieck K, Holzwarth B, Prentzell MT, Boehlke C, Klasener K, Ruf S, Sonntag AG, Maerz L, Grellscheid SN, Kremmer E, Nitschke R, Kuehn EW, Jonker JW, Groen AK, Reth M, Hall MN, Baumeister R. Cell. 2013 Aug 15;154(4):859-74. doi: 10.1016/j.cell.2013.07.031. 10.1016/j.cell.2013.07.031 PubMed 23953116
Related items: