-
PurposeLuciferase reporter plasmid for PE OCT4 enhancer activity
-
Depositing Lab
-
Depositing OrganizationWeizmann Institute of Science
Located in Israel -
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 52415 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 52415-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 52415-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepGL3 promoter
-
Backbone manufacturerPromega
-
Vector typeMammalian Expression, Luciferase
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameProximal element of hOCT4 promoter
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1146
-
Entrez GenePOU5F1 (a.k.a. OCT3, OCT4, OCT4Borf1, OTF-3, OTF3, OTF4, Oct-3, Oct-4, Oct3/4)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Kpn1 (not destroyed)
- 3′ cloning site Xho1 (not destroyed)
- 5′ sequencing primer CTCTCCATCAAAACAAAACGAA
- 3′ sequencing primer TCTTCCAGCGGATAGAATGG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please note that there are several mismatches in between Addgene's quality control and the depositor's sequence. The mismatches do NOT affect plasmid function.
DNA (Catalog # 52415-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 52415-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGL3-human OCT4 PE-SV40-Luc was a gift from Jacob Hanna (Addgene plasmid # 52415 ; http://n2t.net/addgene:52415 ; RRID:Addgene_52415) -
For your References section:
Derivation of novel human ground state naive pluripotent stem cells. Gafni O, Weinberger L, Mansour AA, Manor YS, Chomsky E, Ben-Yosef D, Kalma Y, Viukov S, Maza I, Zviran A, Rais Y, Shipony Z, Mukamel Z, Krupalnik V, Zerbib M, Geula S, Caspi I, Schneir D, Shwartz T, Gilad S, Amann-Zalcenstein D, Benjamin S, Amit I, Tanay A, Massarwa R, Novershtern N, Hanna JH. Nature. 2013 Dec 12;504(7479):282-6. doi: 10.1038/nature12745. Epub 2013 Oct 30. 10.1038/nature12745 PubMed 24172903