Skip to main content

pVITRO-HPV39 L1L2
(Plasmid #52582)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 52582 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pVITRO1-neo-mcs
  • Backbone manufacturer
    InvivoGen
  • Backbone size w/o insert (bp) 6295
  • Total vector size (bp) 9232
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    HPV39 L1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1521

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site BglII (destroyed during cloning)
  • 3′ cloning site NheI (destroyed during cloning)
  • 5′ sequencing primer AAACCACCGCTAATTCAAAGC
  • 3′ sequencing primer GTGGTTTGTCCAAACTCATCAA
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    HPV39 L2
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1416

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site AvrII (destroyed during cloning)
  • 5′ sequencing primer GCCTCTTAGCGGTTCAAAGG
  • 3′ sequencing primer CAAAGGTATTTTCTAAACCCGTTTC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pVITRO-HPV39 L1L2 was a gift from Richard Roden (Addgene plasmid # 52582 ; http://n2t.net/addgene:52582 ; RRID:Addgene_52582)
  • For your References section:

    Impact of inhibitors and L2 antibodies upon the infectivity of diverse alpha and beta human papillomavirus types. Kwak K, Jiang R, Wang JW, Jagu S, Kirnbauer R, Roden RB. PLoS One. 2014 May 9;9(5):e97232. doi: 10.1371/journal.pone.0097232. eCollection 2014. 10.1371/journal.pone.0097232 PubMed 24816794