pGLx2-set1-H1017K
(Plasmid
#53258)
-
PurposeGAL driven LexA-tagged SET1-catalytically dead (H1017K)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 53258 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepGLx2
- Backbone size w/o insert (bp) 6442
- Total vector size (bp) 9676
-
Vector typeYeast Expression
-
Selectable markersURA3
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameSET1
-
SpeciesS. cerevisiae (budding yeast)
-
Insert Size (bp)3240
-
MutationH1017K mutation - catalytically dead
-
Tag
/ Fusion Protein
- LexA (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SmaI (destroyed during cloning)
- 3′ cloning site HindIII (destroyed during cloning)
- 5′ sequencing primer cagggcaataaagtcgaact
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGLx2-set1-H1017K was a gift from Jean Cook (Addgene plasmid # 53258 ; http://n2t.net/addgene:53258 ; RRID:Addgene_53258) -
For your References section:
DNA replication origin function is promoted by H3K4 di-methylation in Saccharomyces cerevisiae. Rizzardi LF, Dorn ES, Strahl BD, Cook JG. Genetics. 2012 Oct;192(2):371-84. doi: 10.1534/genetics.112.142349. Epub 2012 Jul 30. 10.1534/genetics.112.142349 PubMed 22851644