-
PurposeLentiviral vector for expressing a truncated form of FADD (lack of death effector domain) in mammalian cells
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 58263 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepLVX-IRES-Hygro
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 8519
- Total vector size (bp) 8924
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameFADD
-
SpeciesH. sapiens (human)
-
Insert Size (bp)405
-
Mutationversion of FADD (FADD-DD) that contains the FADD death domain (aa30-124), but lacks the death effector domain that binds to caspase-8
-
GenBank IDNM_003824.3
-
Entrez GeneFADD (a.k.a. GIG3, IMD90, MORT1)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer GCAGAGCTCGTTTAGTGAACC
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byAndrew M. Thorburn Professor and Vice Chair, Dept. of Pharmacology University of Colorado Denver Department of Pharmacology
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLVX-FADD-DD was a gift from Joan Massague (Addgene plasmid # 58263 ; http://n2t.net/addgene:58263 ; RRID:Addgene_58263) -
For your References section:
Serpins promote cancer cell survival and vascular co-option in brain metastasis. Valiente M, Obenauf AC, Jin X, Chen Q, Zhang XH, Lee DJ, Chaft JE, Kris MG, Huse JT, Brogi E, Massague J. Cell. 2014 Feb 27;156(5):1002-16. doi: 10.1016/j.cell.2014.01.040. 10.1016/j.cell.2014.01.040 PubMed 24581498