-
Purposeencodes multiple copies of an epitope tag Myc
-
Depositing Lab
-
Depositing OrganizationHHMI, Janelia Research Campus
Located in the United States of America -
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 59757 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 59757-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 59757-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepCAG
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)XL1 Blue
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namesmFP _Myc
-
SpeciesSynthetic
- Promoter CAG
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NotI (not destroyed)
- 3′ cloning site AgeI (not destroyed)
- 5′ sequencing primer GGTTCGGCTTCTGGCGTGTGACC
- 3′ sequencing primer ttaaagcagcgtatccacat
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 59757-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 59757-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCAG_smFP Myc was a gift from Loren Looger (Addgene plasmid # 59757 ; http://n2t.net/addgene:59757 ; RRID:Addgene_59757) -
For your References section:
High-performance probes for light and electron microscopy. Viswanathan S, Williams ME, Bloss EB, Stasevich TJ, Speer CM, Nern A, Pfeiffer BD, Hooks BM, Li WP, English BP, Tian T, Henry GL, Macklin JJ, Patel R, Gerfen CR, Zhuang X, Wang Y, Rubin GM, Looger LL. Nat Methods. 2015 Jun;12(6):568-76. doi: 10.1038/nmeth.3365. Epub 2015 Apr 27. 10.1038/nmeth.3365 PubMed 25915120