-
PurposeYeast D-Amino acid oxidase from Rhodotorula gracilis, optimized for mammalian expression.
-
Depositing Lab
-
Depositing OrganizationShemyakin-Ovchinnikov Institute of Bioorganic Chemistry (INACTIVE)
Located in Russian Federation -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 60344 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 60344-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 60344-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepC1
- Backbone size w/o insert (bp) 3982
- Total vector size (bp) 5083
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)XL1 Blue
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameDAAO
-
SpeciesSynthetic
-
Insert Size (bp)1101
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer ggtgggaggtctatataag
- 3′ sequencing primer cctctacaaatgtggtatgg
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 60344-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 60344-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCMV-DAAO was a gift from Vsevolod Belousov (Addgene plasmid # 60344 ; http://n2t.net/addgene:60344 ; RRID:Addgene_60344) -
For your References section:
How much H(2)O(2) is produced by recombinant D-amino acid oxidase in mammalian cells?. Matlashov ME, Belousov VV, Enikolopov G. Antioxid Redox Signal. 2014 Mar 1;20(7):1039-44. doi: 10.1089/ars.2013.5618. Epub 2013 Oct 23. 10.1089/ars.2013.5618 PubMed 24020354
Map uploaded by the depositor.
