pMTB-Multibow-C
(Plasmid
#60979)
-
PurposePart of Multibow set of constructs--each FP gene is initially not expressed and then adopts a permanent ON or OFF status upon Cre-mediated recombination. Encodes cytoplasmic cerulean
-
Depositing Lab
-
Depositing OrganizationHarvard Medical School
Located in United States of America -
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 60979 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepMTB
-
Vector typeZebrafish
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameCerulean
-
SpeciesSynthetic
- Promoter Bactin2
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer SP6
- 3′ sequencing primer CAGCAGGACCATTTATCATGCTGCTGC
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Multibow constructs contain repetitive loxP sites that make these constructs prone to recombination. The constructs display a few issues with bacterial stability and sequencing that need to be considered when amplifying, storing and using them. First, in our hands Multibow constructs have displayed instability in E.coli cultures and had low yield in Maxi/Midi-preps. Mini-prep is recommended to harvest Multibow constructs. For transformation, we have had success with 5-alpha F'Iq cells (NEB). Second, the sequencing of Multibow constructs may run into problems of low quality/inaccurate reads. A problematic trace file does not necessarily mean the construct is wrong or the sample has mixed sequences. Third, before using the constructs harvested from mini-prep for injections, we recommend a further purification step using DNA purification kits such as MinElute PCR purification kit (Qiagen). All Multibow constructs share a backbone of pMTB vector (AMP resistance) containing the tol2 sites for transgenic insertion and the loxP recombination sites. To validate the variable region, we recommend sequencing with this specific primer: 5'-CAGCAGGACCATTTATCATGCTGCTGC-3', which recognizes the end of the variable region. The Sp6 primer may not provide enough reading length to reach the variable region.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMTB-Multibow-C was a gift from Sean Megason (Addgene plasmid # 60979 ; http://n2t.net/addgene:60979 ; RRID:Addgene_60979) -
For your References section:
Multibow: digital spectral barcodes for cell tracing. Xiong F, Obholzer ND, Noche RR, Megason SG. PLoS One. 2015 May 26;10(5):e0127822. doi: 10.1371/journal.pone.0127822. eCollection 2015. PONE-D-14-56414 [pii] PubMed 26010570