pCMB-GAr
(Plasmid
#61173)
-
PurposeFluorescent reporter for Golgi apparatus GmMAN49-mCherry expressed under MtBCP1 promoter
-
Depositing Lab
-
Depositing OrganizationBoyce Thompson Institute for Plant Research, Inc.
Located in United States of America -
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 61173 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepKm43GW
-
Backbone manufacturerVIB
-
Vector typePlant Expression
-
Selectable markersKanamycin
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGmMAN49-mCherry
-
Insert Size (bp)888
- Promoter MtBCP1
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer ATGGCGAGAGGGAGCAGA
- 3′ sequencing primer TTACTTGTACAGCTCGTCCATG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
GmMan49 contains S3R amino acid change relative to reference sequence (AHW81504.1). Depositor confirms that this mutation does not affect function.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCMB-GAr was a gift from Maria Harrison (Addgene plasmid # 61173 ; http://n2t.net/addgene:61173 ; RRID:Addgene_61173) -
For your References section:
A set of fluorescent protein-based markers expressed from constitutive and arbuscular mycorrhiza-inducible promoters to label organelles, membranes and cytoskeletal elements in Medicago truncatula. Ivanov S, Harrison MJ. Plant J. 2014 Oct 20. doi: 10.1111/tpj.12706. 10.1111/tpj.12706 PubMed 25329881