p414GPD_Hsp82viiB
(Plasmid
#61709)
-
PurposeYeast plasmid with Hsp82 heterodimer construct.
-
Depositing Lab
-
Depositing OrganizationUniversity of Massachusetts, Worcester
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 61709 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonep414
-
Vector typeYeast Expression
-
Selectable markersTRP1
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)XL1 Blue
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameHsp82viiB
-
Alt nameHsp90
-
SpeciesS. cerevisiae (budding yeast)
-
Insert Size (bp)2000
-
MutationHeteromeric coiled coil inserted after amino acid 678; A595C*
-
Entrez GeneHSP82 (a.k.a. YPL240C, HSP90)
- Promoter GPD1
-
Tag
/ Fusion Protein
- 6xHis (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer cagctatgaccatgattacg
- 3′ sequencing primer gtaaaacgacggccagtgagc
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
*Note: This plasmid contains an A595C amino acid residue substitution. This residue change does not alter Hsp90 function in yeast but enables cross-dimer disulfide formation under oxidizing conditions. This construct accurately represents the plasmid as it was used in the associated publication.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
p414GPD_Hsp82viiB was a gift from Dan Bolon (Addgene plasmid # 61709 ; http://n2t.net/addgene:61709 ; RRID:Addgene_61709) -
For your References section:
Designed Hsp90 heterodimers reveal an asymmetric ATPase-driven mechanism in vivo. Mishra P, Bolon DN. Mol Cell. 2014 Jan 23;53(2):344-50. doi: 10.1016/j.molcel.2013.12.024. 10.1016/j.molcel.2013.12.024 PubMed 24462207